Web Signal Scan Program

Database searched: PLACE
This is the sequence you submitted 
>RAFL09-13-A04, 1000 bases, 203953B0 checksum.
TTAAAACCAAAATAGTACGTATACGCTCTAGACGATTCTAAATAGATGAT
TAATTTGGCTCGATTCATTAATTCAAAAAATAATAATATTTAGTGTTTTA
AATTAGAATTAAAATATTAAATAATTATCGGATATTTCAGTGTTTTAAAT
TATTGAGGATGATTTTTGTTTAGTAATGACGTCAGATTGTCTAAGGAATA
GTTTGGGAAAAAAATCTGAATCAAATATGACTAACAAATGGTTATTGGTT
ATTGAACTGGACCATAACAAAAAGACACACACACAAAAAAAAAAACTTTT
TTTATCTGGTTTGCTCCATGGATAAGAATATAGTAGCTAGGATATCCTGA
TCTTTAGATAACGGTAGAACATGTGGCATGTGTTTATTGTTTATTTTTAT
TTTATTTTGAGAACAAAATAGTTACATTGTTTGGTTATATATAAAAAAAA
AACAGACCAAAAAGACAAAACCAAAGCTTAAACAAAAAAAGAAAAGAAAA
ACTTAATTAGACCGGTTAACACTAAACTGGTTTATGTAAAACGGATTCAT
AAATGTATCTAGACATTCACTTACATAAAATTCATCACAAAATTTCACCC
AATTACGGTTTTGATTCGGTATAGGGACCACCTTCAAAATTACCCAATAA
ATAAAGAGTGGATAACAACTAGCATAAAATAATCAAAGCATCCACTAAGA
CACAAAACACAATTTCATAAAGATGATGATGAATCACATAACTTTAAATA
AATATTCTTTCAAAAAGGCAAAACTTTTAAATAAATATCATTCGCCTGTC
GGCCAAGAAAAAAAAAAAGTAAACAAAAATAAATATCATACGTATTGACA
ACAAAAAATTCATACGCCAGTCCAATTACAAATTACACAATATTTAAAAA
TTTAAATAAGGAAAACAGAAGAAGATACAATTTCAAATTAAAAAACAAAA
TACGTGTATATAAAATTGAATAAAACCCCAACAGAAACGTGACACAAAAG


RESULTS OF YOUR SIGNAL SCAN SEARCH REQUEST
 
/tmp/signalseqdone.109: 1000 base pairs
Signal Database File: user.dat

     Factor or Site Name          Loc.(Str.)       Signal Sequence             SITE #
_____________________________________________________________________________________
-10PEHVPSBD               site    753 (+) TATTCT                               S000392
-10PEHVPSBD               site    325 (-) TATTCT                               S000392
ABRELATERD1               site    952 (+) ACGTG                                S000414
ABRELATERD1               site    987 (+) ACGTG                                S000414
ACGTABOX                  site     16 (+) TACGTA                               S000130
ACGTABOX                  site    839 (+) TACGTA                               S000130
ACGTABOX                  site     16 (-) TACGTA                               S000130
ACGTABOX                  site    839 (-) TACGTA                               S000130
ACGTATERD1                site     17 (+) ACGT                                 S000415
ACGTATERD1                site    179 (+) ACGT                                 S000415
ACGTATERD1                site    840 (+) ACGT                                 S000415
ACGTATERD1                site    952 (+) ACGT                                 S000415
ACGTATERD1                site    987 (+) ACGT                                 S000415
ACGTATERD1                site     17 (-) ACGT                                 S000415
ACGTATERD1                site    179 (-) ACGT                                 S000415
ACGTATERD1                site    840 (-) ACGT                                 S000415
ACGTATERD1                site    952 (-) ACGT                                 S000415
ACGTATERD1                site    987 (-) ACGT                                 S000415
ACGTCBOX                  site    178 (+) GACGTC                               S000131
ACGTCBOX                  site    178 (-) GACGTC                               S000131
AMYBOX1                   site    232 (+) TAACARA                              S000020
AMYBOX1                   site    265 (+) TAACARA                              S000020
AMYBOX2                   site    318 (-) TATCCAT                              S000021
ASF1MOTIFCAMV             site    177 (+) TGACG                                S000024
ASF1MOTIFCAMV             site    180 (-) TGACG                                S000024
CAATBOX1                  site    600 (+) CAAT                                 S000028
CAATBOX1                  site    645 (+) CAAT                                 S000028
CAATBOX1                  site    710 (+) CAAT                                 S000028
CAATBOX1                  site    873 (+) CAAT                                 S000028
CAATBOX1                  site    888 (+) CAAT                                 S000028
CAATBOX1                  site    928 (+) CAAT                                 S000028
CAATBOX1                  site    152 (-) CAAT                                 S000028
CAATBOX1                  site    186 (-) CAAT                                 S000028
CAATBOX1                  site    244 (-) CAAT                                 S000028
CAATBOX1                  site    251 (-) CAAT                                 S000028
CAATBOX1                  site    386 (-) CAAT                                 S000028
CAATBOX1                  site    426 (-) CAAT                                 S000028
CAATBOX1                  site    844 (-) CAAT                                 S000028
CAATBOX1                  site    965 (-) CAAT                                 S000028
CCA1ATLHCB1               site    210 (+) AAMAATCT                             S000149
CCAATBOX1                 site    599 (+) CCAAT                                S000030
CCAATBOX1                 site    644 (+) CCAAT                                S000030
CCAATBOX1                 site    872 (+) CCAAT                                S000030
CCAATBOX1                 site    244 (-) CCAAT                                S000030
CIACADIANLELHC            site     48 (-) CAANNNNATC                           S000252
DOFCOREZM                 site    271 (+) AAAG                                 S000265
DOFCOREZM                 site    461 (+) AAAG                                 S000265
DOFCOREZM                 site    473 (+) AAAG                                 S000265
DOFCOREZM                 site    488 (+) AAAG                                 S000265
DOFCOREZM                 site    493 (+) AAAG                                 S000265
DOFCOREZM                 site    653 (+) AAAG                                 S000265
DOFCOREZM                 site    685 (+) AAAG                                 S000265
DOFCOREZM                 site    719 (+) AAAG                                 S000265
DOFCOREZM                 site    764 (+) AAAG                                 S000265
DOFCOREZM                 site    816 (+) AAAG                                 S000265
DOFCOREZM                 site    997 (+) AAAG                                 S000265
DOFCOREZM                 site    296 (-) AAAG                                 S000265
DOFCOREZM                 site    352 (-) AAAG                                 S000265
DOFCOREZM                 site    742 (-) AAAG                                 S000265
DOFCOREZM                 site    757 (-) AAAG                                 S000265
DOFCOREZM                 site    774 (-) AAAG                                 S000265
DPBFCOREDCDC3             site    377 (-) ACACNNG                              S000292
DRECRTCOREAT              site    798 (-) RCCGAC                               S000418
EBOXBNNAPA                site    235 (+) CANNTG                               S000144
EBOXBNNAPA                site    370 (+) CANNTG                               S000144
EBOXBNNAPA                site    377 (+) CANNTG                               S000144
EBOXBNNAPA                site    235 (-) CANNTG                               S000144
EBOXBNNAPA                site    370 (-) CANNTG                               S000144
EBOXBNNAPA                site    377 (-) CANNTG                               S000144
ERELEE4                   site     70 (+) AWTTCAAA                             S000037
ERELEE4                   site    930 (+) AWTTCAAA                             S000037
GATABOX                   site    131 (+) GATA                                 S000039
GATABOX                   site    321 (+) GATA                                 S000039
GATABOX                   site    341 (+) GATA                                 S000039
GATABOX                   site    357 (+) GATA                                 S000039
GATABOX                   site    661 (+) GATA                                 S000039
GATABOX                   site    924 (+) GATA                                 S000039
GATABOX                   site    126 (-) GATA                                 S000039
GATABOX                   site    303 (-) GATA                                 S000039
GATABOX                   site    343 (-) GATA                                 S000039
GATABOX                   site    556 (-) GATA                                 S000039
GATABOX                   site    786 (-) GATA                                 S000039
GATABOX                   site    834 (-) GATA                                 S000039
GT1CONSENSUS              site    206 (+) GRWAAW                               S000198
GT1CONSENSUS              site    207 (+) GRWAAW                               S000198
GT1CONSENSUS              site    496 (+) GRWAAW                               S000198
GT1CONSENSUS              site    807 (+) GRWAAW                               S000198
GT1CONSENSUS              site    910 (+) GRWAAW                               S000198
GT1CONSENSUS              site    124 (-) GRWAAW                               S000198
GT1CONSENSUS              site    639 (-) GRWAAW                               S000198
GT1CONSENSUS              site    301 (-) GRWAAW                               S000198
GT1CORE                   site    514 (+) GGTTAA                               S000125
GTGANTG10                 site    989 (+) GTGA                                 S000378
GTGANTG10                 site    567 (-) GTGA                                 S000378
GTGANTG10                 site    585 (-) GTGA                                 S000378
GTGANTG10                 site    595 (-) GTGA                                 S000378
GTGANTG10                 site    734 (-) GTGA                                 S000378
HEXMOTIFTAH3H4            site    179 (+) ACGTCA                               S000053
HEXMOTIFTAH3H4            site    177 (-) ACGTCA                               S000053
IBOX                      site    321 (+) GATAAG                               S000124
IBOXCORE                  site    321 (+) GATAA                                S000199
IBOXCORE                  site    357 (+) GATAA                                S000199
IBOXCORE                  site    661 (+) GATAA                                S000199
IBOXCORE                  site    125 (-) GATAA                                S000199
IBOXCORE                  site    302 (-) GATAA                                S000199
INRNTPSADB                site    963 (-) YTCANTYY                             S000395
L1BOXATPDF1               site    550 (+) TAAATGYA                             S000386
LTRECOREATCOR15           site    798 (-) CCGAC                                S000153
MARABOX1                  site    646 (+) AATAAAYAAA                           S000063
MARTBOX                   site    397 (+) TTWTWTTWTT                           S000067
MARTBOX                   site    285 (-) TTWTWTTWTT                           S000067
MARTBOX                   site    286 (-) TTWTWTTWTT                           S000067
MARTBOX                   site    443 (-) TTWTWTTWTT                           S000067
MARTBOX                   site    808 (-) TTWTWTTWTT                           S000067
MARTBOX                   site    809 (-) TTWTWTTWTT                           S000067
MYB1AT                    site      4 (+) WAACCA                               S000408
MYB1AT                    site    468 (+) WAACCA                               S000408
MYB1AT                    site    239 (-) WAACCA                               S000408
MYB1AT                    site    246 (-) WAACCA                               S000408
MYB1AT                    site    307 (-) WAACCA                               S000408
MYB1AT                    site    432 (-) WAACCA                               S000408
MYB1AT                    site    528 (-) WAACCA                               S000408
MYB2CONSENSUSAT           site    359 (+) YAACKG                               S000409
MYBCORE                   site    513 (+) CNGTTR                               S000176
MYBCORE                   site    979 (-) CNGTTR                               S000176
MYBCORE                   site    359 (-) CNGTTR                               S000176
MYBGAHV                   site    232 (+) TAACAAA                              S000181
MYBGAHV                   site    265 (+) TAACAAA                              S000181
MYBPLANT                  site    429 (-) MACCWAMC                             S000167
MYBST1                    site    130 (+) GGATA                                S000180
MYBST1                    site    320 (+) GGATA                                S000180
MYBST1                    site    340 (+) GGATA                                S000180
MYBST1                    site    660 (+) GGATA                                S000180
MYBST1                    site    343 (-) GGATA                                S000180
MYCATERD1                 site    370 (+) CATGTG                               S000413
MYCATERD1                 site    377 (+) CATGTG                               S000413
MYCATRD22                 site    370 (-) CACATG                               S000174
MYCATRD22                 site    377 (-) CACATG                               S000174
MYCCONSENSUSAT            site    235 (+) CANNTG                               S000407
MYCCONSENSUSAT            site    370 (+) CANNTG                               S000407
MYCCONSENSUSAT            site    377 (+) CANNTG                               S000407
MYCCONSENSUSAT            site    235 (-) CANNTG                               S000407
MYCCONSENSUSAT            site    370 (-) CANNTG                               S000407
MYCCONSENSUSAT            site    377 (-) CANNTG                               S000407
NRRBNEXTA                 site    690 (-) TAGTGGAT                             S000242
NTBBF1ARROLB              site    741 (+) ACTTTA                               S000273
PALINDROMICCBOXGM         site    177 (+) TGACGTCA                             S000255
PALINDROMICCBOXGM         site    177 (-) TGACGTCA                             S000255
POLASIG1                  site    646 (+) AATAAA                               S000080
POLASIG1                  site    650 (+) AATAAA                               S000080
POLASIG1                  site    747 (+) AATAAA                               S000080
POLASIG1                  site    780 (+) AATAAA                               S000080
POLASIG1                  site    828 (+) AATAAA                               S000080
POLASIG1                  site    969 (+) AATAAA                               S000080
POLASIG1                  site    383 (-) AATAAA                               S000080
POLASIG1                  site    390 (-) AATAAA                               S000080
POLASIG1                  site    396 (-) AATAAA                               S000080
POLASIG1                  site    401 (-) AATAAA                               S000080
POLASIG2                  site    107 (+) AATTAAA                              S000081
POLASIG2                  site    936 (+) AATTAAA                              S000081
POLASIG3                  site     79 (+) AATAAT                               S000088
POLASIG3                  site     82 (+) AATAAT                               S000088
POLASIG3                  site    120 (+) AATAAT                               S000088
POLASIG3                  site    678 (+) AATAAT                               S000088
POLASIG3                  site    149 (-) AATAAT                               S000088
POLLEN1LELAT52            site    490 (+) AGAAA                                S000245
POLLEN1LELAT52            site    495 (+) AGAAA                                S000245
POLLEN1LELAT52            site    806 (+) AGAAA                                S000245
POLLEN1LELAT52            site    983 (+) AGAAA                                S000245
PYRIMIDINEBOXHVEPB1       site    206 (-) TTTTTTCC                             S000298
PYRIMIDINEBOXOSRAMY1A     site    763 (-) CCTTTT                               S000259
RAV1AAT                   site    849 (+) CAACA                                S000314
RAV1AAT                   site    979 (+) CAACA                                S000314
REALPHALGLHCB21           site      5 (+) AACCAA                               S000362
REALPHALGLHCB21           site    469 (+) AACCAA                               S000362
REALPHALGLHCB21           site    245 (-) AACCAA                               S000362
REALPHALGLHCB21           site    431 (-) AACCAA                               S000362
REBETALGLHCB21            site    129 (+) CGGATA                               S000363
ROOTMOTIFTAPOX1           site     86 (+) ATATT                                S000098
ROOTMOTIFTAPOX1           site    114 (+) ATATT                                S000098
ROOTMOTIFTAPOX1           site    132 (+) ATATT                                S000098
ROOTMOTIFTAPOX1           site    752 (+) ATATT                                S000098
ROOTMOTIFTAPOX1           site    890 (+) ATATT                                S000098
ROOTMOTIFTAPOX1           site     85 (-) ATATT                                S000098
ROOTMOTIFTAPOX1           site    113 (-) ATATT                                S000098
ROOTMOTIFTAPOX1           site    224 (-) ATATT                                S000098
ROOTMOTIFTAPOX1           site    327 (-) ATATT                                S000098
ROOTMOTIFTAPOX1           site    751 (-) ATATT                                S000098
ROOTMOTIFTAPOX1           site    784 (-) ATATT                                S000098
ROOTMOTIFTAPOX1           site    832 (-) ATATT                                S000098
ROOTMOTIFTAPOX1           site    889 (-) ATATT                                S000098
SEF1MOTIF                 site    890 (+) ATATTTAWW                            S000006
SEF1MOTIF                 site    747 (-) ATATTTAWW                            S000006
SEF1MOTIF                 site    780 (-) ATATTTAWW                            S000006
SEF1MOTIF                 site    828 (-) ATATTTAWW                            S000006
SEF4MOTIFGM7S             site    162 (+) RTTTTTR                              S000103
SEF4MOTIFGM7S             site    393 (+) RTTTTTR                              S000103
SEF4MOTIFGM7S             site    824 (-) RTTTTTR                              S000103
SEF4MOTIFGM7S             site    895 (-) RTTTTTR                              S000103
SP8BFIBSP8BIB             site     11 (-) TACTATT                              S000184
TAAAGSTKST1               site    652 (+) TAAAG                                S000387
TAAAGSTKST1               site    718 (+) TAAAG                                S000387
TAAAGSTKST1               site    352 (-) TAAAG                                S000387
TAAAGSTKST1               site    742 (-) TAAAG                                S000387
TATABOX4                  site    438 (+) TATATAA                              S000111
TATABOX4                  site    957 (+) TATATAA                              S000111
TATABOX4                  site    435 (-) TATATAA                              S000111
TATABOX5                  site    391 (+) TTATTT                               S000203
TATABOX5                  site    397 (+) TTATTT                               S000203
TATABOX5                  site    402 (+) TTATTT                               S000203
TATABOX5                  site     78 (-) TTATTT                               S000203
TATABOX5                  site    119 (-) TTATTT                               S000203
TATABOX5                  site    649 (-) TTATTT                               S000203
TATABOX5                  site    677 (-) TTATTT                               S000203
TATABOX5                  site    746 (-) TTATTT                               S000203
TATABOX5                  site    779 (-) TTATTT                               S000203
TATABOX5                  site    827 (-) TTATTT                               S000203
TATABOX5                  site    904 (-) TTATTT                               S000203
TATABOXOSPAL              site    891 (+) TATTTAA                              S000400
TATABOXOSPAL              site    117 (-) TATTTAA                              S000400
TATABOXOSPAL              site    744 (-) TATTTAA                              S000400
TATABOXOSPAL              site    777 (-) TATTTAA                              S000400
TATABOXOSPAL              site    902 (-) TATTTAA                              S000400
TATAPVTRNALEU             site    438 (-) TTTATATA                             S000340
TATAPVTRNALEU             site    957 (-) TTTATATA                             S000340
TATCCACHVAL21             site    658 (-) TATCCAC                              S000416
TATCCAOSAMY               site    319 (-) TATCCA                               S000403
TATCCAOSAMY               site    659 (-) TATCCA                               S000403
TATCCAYMOTIFOSRAMY3D      site    318 (-) TATCCAY                              S000256
TATCCAYMOTIFOSRAMY3D      site    658 (-) TATCCAY                              S000256
TGACGTVMAMY               site    177 (+) TGACGT                               S000377
TGACGTVMAMY               site    179 (-) TGACGT                               S000377
WBOXATNPR1                site    845 (+) TTGAC                                S000390
ZDNAFORMINGATCAB1         site    950 (+) ATACGTGT                             S000321



-------------------------------------------
 
 


If you use this program in published research, please cite: Higo, K., Y. Ugawa, M. Iwamoto and T. Korenaga (1999) Plant cis-acting regulatory DNA elements (PLACE) database:1999. Nucleic Acids Research Vol.27 No.1 pp. 297-300.

For more information about the SignalScan Program, please contact Dr Dan S. Prestridge Tele:(612) 625-3744 Advanced Biosciences Computing Center, E-mail:danp@biosci.umn.edu 1479 Gortner Ave. University of Minnesota St. Paul, MN 55108
The TFD data is at the gopher site, gopher://genome-gopher.stanford.edu.
For more information about the WebSignalScan service, please contact Meena Sakharkar, meena@biomed.nus.sg, BioInformatics centre, NUS .